Dr. B, I'm not sure which week Wiki 8 corresponds to but I'm missing a grade for it. It's a blank, so I'm not sure if you just haven't put the grades in for it or if I really have a 0. Could you please replace it with the Freebee from Journal Club 4? Thank you!
Week 15:
The results from the virtual screening run of CB KIN library for Stp1:
#
Score
S(PLP
) S(hbond)
S(cho)
S(metal)
DE(clash)
DE(tors)
Ligand name
#
individual
for each
ligand docke
d in GOLD.
#
Format is:
Rank
File conta
ining a l
isting of the
fitness of
the top-r
anked
1
72.17
-60.21
2
0
1.96
0.67
5.03
'5230025|CB-kin_UT|sdf|20|dock8'
2
71.67
-58.15
2.68
0
0.99
0
0.77
'5176331|CB-kin_UT|sdf|8|dock10'
3
69.41
-62.44
1
0
0.97
0
0.93
'5219722|CB-kin_UT|sdf|19|dock4'
4
69.29
-46.34
2
0
2.98
0
2
'5218908|CB-kin_UT|sdf|18|dock8'
5
68.83
-58.4
0
0
1.88
0
2.04
'5210935|CB-kin_UT|sdf|10|dock3'
6
68.48
-61.24
2
0
0.94
0
2.41
'5114378|CB-kin_UT|sdf|3|dock4'
7
66.71
-56.21
0.91
0
1.9
0
2.14
'5128798|CB-kin_UT|sdf|4|dock10'
8
66.29
-58.39
1.5
0
0.9
0
1.89
'5173918|CB-kin_UT|sdf|6|dock5'
9
65.62
-52.65
1.24
0
1.99
0
3.73
'5210849|CB-kin_UT|sdf|9|dock4'
10
64.51
-51.12
1
0
1.9
0
2.36
'5211137|CB-kin_UT|sdf|11|dock1'
So far, both Cb306 and CbKIN have been screened.
I also worked on the inhibition assays for PSTP. Here is the graph generated from the data collected:
The inhibition assay weren't very successful because the control and positive controls (A,B,C) all had very low absorbance values. Therefore, when the compound (552480) was supposed to be "working," the absorbance did not decrease by that much. In the future, the enzyme concentration can be increased so that the absorbance is higher to begin with. That way when the numbers on the graph start to decrease, it will be clear to see.
Week 14:
The results from the virtual screening run of CB 306 library for Stp1:
Rank
Score
S(PLP)
S(hbond)
S(cho)
S(metal)
DE(clash)
DE(tors)
intcor
Ligand name
1
75
-30.96
3
0
5.96
0
0.38
0.01
'5101823|cb_306_3d|sdf|6|dock2'
2
73.34
-34.42
2
0
5.98
0
1.49
0.01
'5101823|cb_306_3d|sdf|6|dock3'
3
72.84
-33.82
1.92
0
5.97
0
1.29
0.01
'5101823|cb_306_3d|sdf|6|dock1'
4
69.46
-29.89
2
0
5.88
0
0.85
0.01
'5101823|cb_306_3d|sdf|6|dock4'
5
51.53
-28.2
1
1.67
2.59
0
0.11
0
'4000001|cb_306_3d|sdf|1|dock3'
6
51.22
-28.75
1
1.57
2.56
0
0.3
0
'4000001|cb_306_3d|sdf|1|dock1'
7
51
-28.24
1
1.66
2.52
0
0.18
0
'4000001|cb_306_3d|sdf|1|dock2'
8
50.71
-35.17
1.53
0
1.99
0
0.48
0
'4102009|cb_306_3d|sdf|5|dock3'
9
50.68
-34.68
1.66
0
2
0
0.47
0
'4102009|cb_306_3d|sdf|5|dock1'
10
49.75
-36.19
0.89
0
1.96
0
0.43
0
'4102009|cb_306_3d|sdf|5|dock2'
This week I started scanning the CBKIN library and am currently on the second run. I also did my first enzyme assays, the results of which can be seen below:
(The actual graph of the nano drop is a .cmbl file which isn't opening..so I'll open it up in lab and then paste it on here).
Fig: The graph compares the enzyme concentration (x axis) in microliters versus the absorbance (y axis) .
The enzyme assays did not go as well as they could have gone. As the enzyme concentration increased, from left to right, they absorbance measured by the spectrophotometer was also supposed to increase. The absorbance increased until 20 uL of the enzyme, dropped, increased again, and dropped. THe overall trend shows that the absorbance increased, which is good.
Week 13:
Ok. Show some of you scores -Dr. B 11/2612
The results from the virtual screening are back, but ones I opened the .lst file which was supposed to contain the top 32 ligands, the file contained 408 ligands. This is more than I actually ran, so I'll have to see what the issue is before I can go ahead and make my table in excel for the best ranking ligands.
Week 12:
This week after the protein was done and stored for long term, I ran my first virtual screening run, and then after it was complete, I ran Run 2. THe results of those should come in this week so I'll be able to analyze the best ligands before Thanksgiving break.
Week 11:
Good - Dr. B 11/19/12
First step this week was protein characterization for PSTP, and the gel for that had a couple of bands we didn't expect, but here's the image of it before drying:
Ruifei W, Brandon N, Suman A PSTP protein gel Lane 1: Skip Lane 2: NEB Protein Ladder Lane 3: Sample 5 trial 1 Lane 4: Sample 6 trial 1 Lane 5: Sample 7 (elution 1) trial 1 Lane 6: Sample 8 (elution 1) trial 1 Lane 7: Sample 5 trial 2 Lane 8: Sample 6 trial 2 Lane 9: Sample 7 (elution 1) trial 2 Lane 10: Sample 8 (elution 1) trial 2
We then continued working on for protein expression and purification. After sonication got done last week and sample 2 was saved, the protein was purified. The results before the FPLC were measured using nanodrop and were 3.73 ng/ul and 3.74 ng/ul.
pstp bn rw sa.jpg
pstp absorbance bn rw sa.jpg
After FPLC, here are the protein concentrations. The concentrations were .88 ng/ul and .82 ng/ul. For the FPLC results, we only got one peak, which means the sample didn't have many contaminations, even though the peak wasn't as high as we would have liked it to be.
I then added glycerol to the protein sample and stored it in my box in the -20C fridge.
I also got to run my virtual screening job on GOLD for STP1 in the CB 206 library because the cores opened up. I expect it to be done by Monday at the latest and will then do the second run for the top 8 ligands.
Week 10:
This week we used Sadhna's protein (PSTP) for protein expression. We are on Day 5 (sonication), from which we will continue on Tuesday. I also remade another gel to include the results of my primary PCR and a 100 kb ladder. Unfortunately, I accidentally let the gel run for a bit too long and the samples almost ran off the gel.
Suman Augsteen 11/2/2012
Lane 1: Blank
Lane 2: 100 kb ladder
Lane 3: Primary PCR Sample
Lane 4: Secondary PCR Sample with oligo mix 1 & 18
Lane 5: Secondary PCR Sample with oligo mix 3 & 16
I was hoping this gel would be a lot clearer and show me which PCR sample was correctly aligned with my protein which is 738 bp long, but that didn't happen.
I also started my virtual screening run for my own target. I have created the conf file and now just have to check it for any mistakes and submit my run. I was not able to do this on Saturday because the cores were all pretty full.
Week 9:
This week after the meeting, I ran a gel with each of the three variations of my secondary PCR.
Suman Augsteen 10/28/12
Lane 1: Blank
Lane 2: 1kb ladder
Lane 3: Secondary PCR Sample (Tail End Primers)
Lane 4: Secondary PCR Sample with oligo mix 1 & 18
Lane 5: Secondary PCR Sample with oligo mix 3 & 16
I'm not sure if the bands are fine, but with this one, I forgot to use one of the lanes to put my primary PCR sample in. I plan on running another gel with a 100 kb ladder (since i have 738 base pairs) and also using one of the lanes as the primary PCR sample one. Also, the sample with the tail end primers didn't show up again.
Week 8:
102112 - good -- keep trying on the secondary variations in temp, etc. Dr. B
This week I ran a gel with both my primary and secondary PCR results on there.
Suman Augsteen 10/18/12
PCR for STP1
Lane 1: Blank
Lane 2: 1 kb ladder
Lane 3: Primary PCR Sample
Lane 4: Secondary PCR Sample
Lane 3 was a lot lighter than we'd like it to be and Lane 4 didn't show up at all. So I remade the primary sample. This time, I used a different PCR machine and changed the annealing temperature to 56 degrees celcius. I was also a lot more careful with keeping my samples on ice at all times and being very careful not to contaminate my sample. Below is a gel check for the primary PCR before I continue onto the secondary PCR. It came out a lot better than the first one, so hopefully the secondary PCR I do using this sample will work as well.
Suman Augsteen 10/19/12
Gel check for primary PCR of stp1
Lane 1: blank
Lane 2: 1 kb ladder
Lane 3: Primary PCR Sample
Week 7:
101612 - Suman - good gel and good VS results. However the Primary PCR doesn't look like much. Play around with the annealing temps on your PCR. -- Dr. B
First, I completed my virtual screening refresher. The results are uploaded in google docs, but here is the table for the top 10 ligands:
#
individual
for each
ligand docked
in GOLD.
#
Format is:
#
Fitness
S(hb_e
xt) S(vdw_ext)
S(hb_int)
S(int)
Ligand name
#
File contai
ning a l
isting of the
fitness of
the top-ran
1
82.89
6
61.38
0
-7.51
9039798|CB5k_10|sdf|947|dock4'
2
81.36
4.65
59.59
0
-5.24
'9057940|CB5k_10|sdf|3998|dock2'
3
80.99
9.17
55.9
0
-5.04
'9036564|CB5k_10|sdf|426|dock5'
4
80.99
6
53.56
0
1.33
'9040519|CB5k_10|sdf|1056|dock4'
5
80.04
16.11
49.37
0
-3.96
'9038483|CB5k_10|sdf|723|dock3'
6
79.29
9.67
58.26
0
-10.49
'9061456|CB5k_10|sdf|4253|dock7'
7
79.17
6.26
61.22
0
-11.27
9037146|CB5k_10|sdf|529|dock4'
8
78.28
10
59.35
0
-13.33
'9040933|CB5k_10|sdf|1132|dock9'
9
77.62
11.08
56.8
0
-11.55
'9049544|CB5k_10|sdf|2822|dock7'
10
77.35
12
53.64
0
-8.4
'9043817|CB5k_10|sdf|1728|dock3'
Next, I completed the primary PCR for my target, STP1, and then did a gel check. Here is the gel image:
Suman Augsteen
Primary PCR 1 Gel Check- STP1
Lane 1: Empty
Lane 2: 1kb ladder
Lane 3: Primary PCR sample
I also completed my secondary PCR, but I haven't ran the gel for both primary and secondary together yet. I plan on doing that first thing next week.
Week 6:
This week I designed my designed my forward and reverse primers for my target. The two sequences were then submitted in a google doc where they can be ordred so we can proceed with the cloning. Here are some images from the process:
This is the final sequence that I came up with.
Forward: TACTTCCAATCCATGGAAATATCTCTTTTAACAGATATT Reverse: TATCCACCTTTACTGTTATTCTTCGTCCGTCAC
Note: The reverse I designed was wrong so the one I'll be using is Ruifei's.
The second thing I did was make my oligo mix. STP1 genes were located in wells B10 to D3. The mix was then stored in the -20 fridge.
Week 5:
1000112 - Suman, ok your 1st PCR kind of worked (extra bands are troublesome). Your second one did not work. But I just want people to have tried it. You are now good to go onto cloning of your target. However, where is your Primer Design?
--- Dr. B
This week I worked on several different protocols. One was a redo of last week's lab, which didn't give me desired results, and the other two are current.
1. The first thing I did this week was to grow out my pNIC-BSA4 pellets again to do midi prep. I need the DNA yield later down my research, so this will be an important step to complete successfully. For now, the protein pellets are stored and I'll do the midi prep kit next week (or maybe tomorrow on Saturday??)
2. I finished my PyMol refresher and the complete report can be found in the VDS class google docs. It involved 4 main molecules:
2H2Q
3CL9
1U72
3HBB
A result of the protein blast which I ran after I superimposed the human (1U72) and the bacteria (3CL9) molecules:
3. I used the PCR1 tubes I had prepared last week to run the actual gel. I'm not sure how this is supposed to look alike, but Janice says it's contamiated :(
Here are the results of the gel. It's the same gel in both of the pictures, but they both came out really great and I couldn't decide between the two.
Lane 1: empty
Lane 2: 100 bp ladder
Lane 3: Sample A
Lane 4: Sample B
Lane 5: Sample C
Lane 6: Sample D- NO DNA
I'll go to lab tomorrow and do PCR2, and hopefully primer design as well. We'll consider those as next weeks so I can write about them when I'm actually fully done with the protocol and not just half way through.
Results of PCR 2:
Suman Augsteen
Secondary PCR- pNIC-Bsa4
Lane 1: blank
Lane 2: Sample A
Lane 3: Sample B
Lane 4: Sample C
Lane 5: Sample D (no DNA)
This was so so horrible. None of the wells showed up, which could be due to contamination, bad timing, etc. PCR's are very sensitive so it could've been any number of mistakes. The only thing that worked was the DNA ladder, which means that the gel was working.
Week 4:
Suman - ok, try again and make new cell pellets for Midiprep -- Dr. B
Update: The results of the midi prep #1 are online in the google docs spreadsheet now!
First this week, I worked on my midi-prep, which I used my protein pellets from pNIC-BSA4 for. The point was to filter out the bacteria DNA, and then measure the concentration of it via nanodrop. The first time, the concentration was -2.5, the second time, it was -1.9.
I have to do midi prep again, so I also grew bacteria this week. It was incubated overnight, and then I spun it down and have stored the protein pellets.
Secondly, I worked on PyMol Refresher. It's not done yet, I only did the first two PyMol sets of the first two bacteria, but it will be in the GoogleDocs folder by next Friday. The images will all be available there.
Finally, I also did the first part of PCR. The goal was to used the forward and reverse primers to amplify the purple protein in pBGR-22. I made a master mix using primers, templates, buffers, Taq (all listed specifically in the protocol), and made four tubes (A, B,C, and D). The tubes were put in the PCR machine, and then stored. I'll run the gels next week to get the results.
Week 3:
Suman -- good. Try to not have your image stretched! --Dr.B 091812
I worked on two protocols this week: RE Enzyme Digest and DNA Transformation.
1. Below are the results from my RE Enzyme Digest, in which we had to perform an RE Digest of the enzyme pGBR22. I then created an agarose gel and ran it, and came up with the results shown below. What each lane stands for has been annotated below, and the gel turned out really well. The heavier bands are more towards the wells, while the lighter ones were able to travel longer. In lanes 4-6, the cut DNA ( which went from circular to linear) was able to travel through the gel because it weighed less. Therefore, the less thick strands are more likely to be towards the bottom away from the wells, while the thicker, uncut strands are more likely to be near the top. Similarly, the lighter/shorter strands are harder to take a picture of under fluorescent light, which is why the bands towards the bottom of the gel are lighter in color than the ones towards the top.
9/13/2012
Suman Augsteen
RE Digest of pGBR22
Lane 1: Skip
Lane 2: 1kb DNA ladder (NEB)
Lane 3: Uncut plasmid
Lane 4: EcoRI
Lane 5: PvuII
Lane 6: EcoRI and PvuII
Last week, I made a digital gel in the "Analyzing DNA Sequence" Lab with the same samples (EcoRI and PvuII). This is what the virtual gel looked like. They look different, but I'm pretty sure my lab gel is more accurate than my virtual gel.
2. In DNA transformation, which was spread out over 3 days, the object was to grow bacteria (pNICBsa4) and then extract the protein out in pellets. This was done by growing the colonies in a plate, putting them in LB broth in a flask, and then growing even more bacteria and protein overnight (12-16 hours). The liquid was then spun down, and the protein pellet was extracted. I have stored my pellets in the -4C fridge..they'll come handy later on.
Week 2:
This week in lab, I completed two protocols which allowed me to submit my DNA for sequencing (on Monday). I did primer dilutions, and then prepared two tubes with forward and reverse DNA in a vector (pNIP) that will hold my .
Then, I completed my DNA sequence analysis. This wasn't anything new, just over the purple corral protein we had used last semester. It was important to use a protein that we already had experience with so we could analyze the data knowing what the actual answers are. We compared the purple protein's original DNA to it's gene in a vector and ran protein BLASTS, etc. In the end, I ended up making an "electronic gel" that should be similar to what will happen in lab during REdigest next week. It includes a 1kb ladder, and also the bands for the enzymes ecoRI, PuvII, and both of them together. Here's a snapshot:
The final file is submitted under "Results and Data"-->Anazyle DNA Sequence Results in google docs.
Week 1:
This week, I found my target protein to focus this semester's research on. It was from my infectious disease last year: neonatal septicemia. The target is STP1, and the organism is streptococcus agalactiae. Here's a picture from pdb:
After deciding this was the protein I wanted to work on, I made my target page, which has more detailed information about this target.
Week 15:
The results from the virtual screening run of CB KIN library for Stp1:
I also worked on the inhibition assays for PSTP. Here is the graph generated from the data collected:
The inhibition assay weren't very successful because the control and positive controls (A,B,C) all had very low absorbance values. Therefore, when the compound (552480) was supposed to be "working," the absorbance did not decrease by that much. In the future, the enzyme concentration can be increased so that the absorbance is higher to begin with. That way when the numbers on the graph start to decrease, it will be clear to see.
Week 14:
The results from the virtual screening run of CB 306 library for Stp1:
This week I started scanning the CBKIN library and am currently on the second run. I also did my first enzyme assays, the results of which can be seen below:
(The actual graph of the nano drop is a .cmbl file which isn't opening..so I'll open it up in lab and then paste it on here).
Fig: The graph compares the enzyme concentration (x axis) in microliters versus the absorbance (y axis) .
The enzyme assays did not go as well as they could have gone. As the enzyme concentration increased, from left to right, they absorbance measured by the spectrophotometer was also supposed to increase. The absorbance increased until 20 uL of the enzyme, dropped, increased again, and dropped. THe overall trend shows that the absorbance increased, which is good.
Week 13:
Ok. Show some of you scores -Dr. B 11/2612
The results from the virtual screening are back, but ones I opened the .lst file which was supposed to contain the top 32 ligands, the file contained 408 ligands. This is more than I actually ran, so I'll have to see what the issue is before I can go ahead and make my table in excel for the best ranking ligands.
Week 12:
This week after the protein was done and stored for long term, I ran my first virtual screening run, and then after it was complete, I ran Run 2. THe results of those should come in this week so I'll be able to analyze the best ligands before Thanksgiving break.
Week 11:
Good - Dr. B 11/19/12
First step this week was protein characterization for PSTP, and the gel for that had a couple of bands we didn't expect, but here's the image of it before drying:
Ruifei W, Brandon N, Suman A
PSTP protein gel
Lane 1: Skip
Lane 2: NEB Protein Ladder
Lane 3: Sample 5 trial 1
Lane 4: Sample 6 trial 1
Lane 5: Sample 7 (elution 1) trial 1
Lane 6: Sample 8 (elution 1) trial 1
Lane 7: Sample 5 trial 2
Lane 8: Sample 6 trial 2
Lane 9: Sample 7 (elution 1) trial 2
Lane 10: Sample 8 (elution 1) trial 2
We then continued working on for protein expression and purification. After sonication got done last week and sample 2 was saved, the protein was purified. The results before the FPLC were measured using nanodrop and were 3.73 ng/ul and 3.74 ng/ul.
After FPLC, here are the protein concentrations. The concentrations were .88 ng/ul and .82 ng/ul. For the FPLC results, we only got one peak, which means the sample didn't have many contaminations, even though the peak wasn't as high as we would have liked it to be.
I then added glycerol to the protein sample and stored it in my box in the -20C fridge.
I also got to run my virtual screening job on GOLD for STP1 in the CB 206 library because the cores opened up. I expect it to be done by Monday at the latest and will then do the second run for the top 8 ligands.
Week 10:
This week we used Sadhna's protein (PSTP) for protein expression. We are on Day 5 (sonication), from which we will continue on Tuesday. I also remade another gel to include the results of my primary PCR and a 100 kb ladder. Unfortunately, I accidentally let the gel run for a bit too long and the samples almost ran off the gel.
Suman Augsteen 11/2/2012
Lane 1: Blank
Lane 2: 100 kb ladder
Lane 3: Primary PCR Sample
Lane 4: Secondary PCR Sample with oligo mix 1 & 18
Lane 5: Secondary PCR Sample with oligo mix 3 & 16
I was hoping this gel would be a lot clearer and show me which PCR sample was correctly aligned with my protein which is 738 bp long, but that didn't happen.
I also started my virtual screening run for my own target. I have created the conf file and now just have to check it for any mistakes and submit my run. I was not able to do this on Saturday because the cores were all pretty full.
Week 9:
This week after the meeting, I ran a gel with each of the three variations of my secondary PCR.
Suman Augsteen 10/28/12
Lane 1: Blank
Lane 2: 1kb ladder
Lane 3: Secondary PCR Sample (Tail End Primers)
Lane 4: Secondary PCR Sample with oligo mix 1 & 18
Lane 5: Secondary PCR Sample with oligo mix 3 & 16
I'm not sure if the bands are fine, but with this one, I forgot to use one of the lanes to put my primary PCR sample in. I plan on running another gel with a 100 kb ladder (since i have 738 base pairs) and also using one of the lanes as the primary PCR sample one. Also, the sample with the tail end primers didn't show up again.
Week 8:
102112 - good -- keep trying on the secondary variations in temp, etc. Dr. B
This week I ran a gel with both my primary and secondary PCR results on there.
Suman Augsteen 10/18/12
PCR for STP1
Lane 1: Blank
Lane 2: 1 kb ladder
Lane 3: Primary PCR Sample
Lane 4: Secondary PCR Sample
Lane 3 was a lot lighter than we'd like it to be and Lane 4 didn't show up at all. So I remade the primary sample. This time, I used a different PCR machine and changed the annealing temperature to 56 degrees celcius. I was also a lot more careful with keeping my samples on ice at all times and being very careful not to contaminate my sample. Below is a gel check for the primary PCR before I continue onto the secondary PCR. It came out a lot better than the first one, so hopefully the secondary PCR I do using this sample will work as well.
Suman Augsteen 10/19/12
Gel check for primary PCR of stp1
Lane 1: blank
Lane 2: 1 kb ladder
Lane 3: Primary PCR Sample
Week 7:
101612 - Suman - good gel and good VS results. However the Primary PCR doesn't look like much. Play around with the annealing temps on your PCR. -- Dr. B
First, I completed my virtual screening refresher. The results are uploaded in google docs, but here is the table for the top 10 ligands:
Next, I completed the primary PCR for my target, STP1, and then did a gel check. Here is the gel image:
Suman Augsteen
Primary PCR 1 Gel Check- STP1
Lane 1: Empty
Lane 2: 1kb ladder
Lane 3: Primary PCR sample
I also completed my secondary PCR, but I haven't ran the gel for both primary and secondary together yet. I plan on doing that first thing next week.
Week 6:
This week I designed my designed my forward and reverse primers for my target. The two sequences were then submitted in a google doc where they can be ordred so we can proceed with the cloning. Here are some images from the process:
This is the final sequence that I came up with.
Forward: TACTTCCAATCCATGGAAATATCTCTTTTAACAGATATT
Reverse: TATCCACCTTTACTGTTATTCTTCGTCCGTCAC
Note: The reverse I designed was wrong so the one I'll be using is Ruifei's.
The second thing I did was make my oligo mix. STP1 genes were located in wells B10 to D3. The mix was then stored in the -20 fridge.
Week 5:
1000112 - Suman, ok your 1st PCR kind of worked (extra bands are troublesome). Your second one did not work. But I just want people to have tried it. You are now good to go onto cloning of your target. However, where is your Primer Design?
--- Dr. B
This week I worked on several different protocols. One was a redo of last week's lab, which didn't give me desired results, and the other two are current.
1. The first thing I did this week was to grow out my pNIC-BSA4 pellets again to do midi prep. I need the DNA yield later down my research, so this will be an important step to complete successfully. For now, the protein pellets are stored and I'll do the midi prep kit next week (or maybe tomorrow on Saturday??)
2. I finished my PyMol refresher and the complete report can be found in the VDS class google docs. It involved 4 main molecules:
2H2Q
3CL9
1U72
3HBB
A result of the protein blast which I ran after I superimposed the human (1U72) and the bacteria (3CL9) molecules:
3. I used the PCR1 tubes I had prepared last week to run the actual gel. I'm not sure how this is supposed to look alike, but Janice says it's contamiated :(
Here are the results of the gel. It's the same gel in both of the pictures, but they both came out really great and I couldn't decide between the two.
Lane 1: empty
Lane 2: 100 bp ladder
Lane 3: Sample A
Lane 4: Sample B
Lane 5: Sample C
Lane 6: Sample D- NO DNA
I'll go to lab tomorrow and do PCR2, and hopefully primer design as well. We'll consider those as next weeks so I can write about them when I'm actually fully done with the protocol and not just half way through.
Results of PCR 2:
Suman Augsteen
Secondary PCR- pNIC-Bsa4
Lane 1: blank
Lane 2: Sample A
Lane 3: Sample B
Lane 4: Sample C
Lane 5: Sample D (no DNA)
This was so so horrible. None of the wells showed up, which could be due to contamination, bad timing, etc. PCR's are very sensitive so it could've been any number of mistakes. The only thing that worked was the DNA ladder, which means that the gel was working.
Week 4:
Suman - ok, try again and make new cell pellets for Midiprep -- Dr. B
Update: The results of the midi prep #1 are online in the google docs spreadsheet now!
First this week, I worked on my midi-prep, which I used my protein pellets from pNIC-BSA4 for. The point was to filter out the bacteria DNA, and then measure the concentration of it via nanodrop. The first time, the concentration was -2.5, the second time, it was -1.9.
I have to do midi prep again, so I also grew bacteria this week. It was incubated overnight, and then I spun it down and have stored the protein pellets.
Secondly, I worked on PyMol Refresher. It's not done yet, I only did the first two PyMol sets of the first two bacteria, but it will be in the GoogleDocs folder by next Friday. The images will all be available there.
Finally, I also did the first part of PCR. The goal was to used the forward and reverse primers to amplify the purple protein in pBGR-22. I made a master mix using primers, templates, buffers, Taq (all listed specifically in the protocol), and made four tubes (A, B,C, and D). The tubes were put in the PCR machine, and then stored. I'll run the gels next week to get the results.
Week 3:
Suman -- good. Try to not have your image stretched! --Dr.B 091812
I worked on two protocols this week: RE Enzyme Digest and DNA Transformation.
1. Below are the results from my RE Enzyme Digest, in which we had to perform an RE Digest of the enzyme pGBR22. I then created an agarose gel and ran it, and came up with the results shown below. What each lane stands for has been annotated below, and the gel turned out really well. The heavier bands are more towards the wells, while the lighter ones were able to travel longer. In lanes 4-6, the cut DNA ( which went from circular to linear) was able to travel through the gel because it weighed less. Therefore, the less thick strands are more likely to be towards the bottom away from the wells, while the thicker, uncut strands are more likely to be near the top. Similarly, the lighter/shorter strands are harder to take a picture of under fluorescent light, which is why the bands towards the bottom of the gel are lighter in color than the ones towards the top.
9/13/2012
Suman Augsteen
RE Digest of pGBR22
Lane 1: Skip
Lane 2: 1kb DNA ladder (NEB)
Lane 3: Uncut plasmid
Lane 4: EcoRI
Lane 5: PvuII
Lane 6: EcoRI and PvuII
Last week, I made a digital gel in the "Analyzing DNA Sequence" Lab with the same samples (EcoRI and PvuII). This is what the virtual gel looked like. They look different, but I'm pretty sure my lab gel is more accurate than my virtual gel.
2. In DNA transformation, which was spread out over 3 days, the object was to grow bacteria (pNICBsa4) and then extract the protein out in pellets. This was done by growing the colonies in a plate, putting them in LB broth in a flask, and then growing even more bacteria and protein overnight (12-16 hours). The liquid was then spun down, and the protein pellet was extracted. I have stored my pellets in the -4C fridge..they'll come handy later on.
Week 2:
This week in lab, I completed two protocols which allowed me to submit my DNA for sequencing (on Monday). I did primer dilutions, and then prepared two tubes with forward and reverse DNA in a vector (pNIP) that will hold my .
Then, I completed my DNA sequence analysis. This wasn't anything new, just over the purple corral protein we had used last semester. It was important to use a protein that we already had experience with so we could analyze the data knowing what the actual answers are. We compared the purple protein's original DNA to it's gene in a vector and ran protein BLASTS, etc. In the end, I ended up making an "electronic gel" that should be similar to what will happen in lab during REdigest next week. It includes a 1kb ladder, and also the bands for the enzymes ecoRI, PuvII, and both of them together. Here's a snapshot:
The final file is submitted under "Results and Data"-->Anazyle DNA Sequence Results in google docs.
Week 1:
This week, I found my target protein to focus this semester's research on. It was from my infectious disease last year: neonatal septicemia. The target is STP1, and the organism is streptococcus agalactiae. Here's a picture from pdb:
After deciding this was the protein I wanted to work on, I made my target page, which has more detailed information about this target.